| Detail of EST/Unigene TCSL74435 |
| Acc. | TCSL74435 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Transcription factor MYB44 OS=Arabidopsis thaliana E-value=1e-63; Transcriptional activator Myb OS=Xenopus laevis E-value=1e-32; Transcriptional activator Myb OS=Mus musculus E-value=1e-32; Transcriptional activator Myb OS=Homo sapiens E-value=1e-32; Transcriptional activator Myb OS=Gallus gallus E-value=1e-32; |
| Length | 1660 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435 (20 ESTs); SL_MicroLEAF3 (4 ESTs); SL_maturing_fruit (3 ESTs); SL_TAMU_CALLUS (2 ESTs); SL_ROOT (2 ESTs); LIBEST_024426 (2 ESTs); SL_TAMU (2 ESTs); SL_CALLUS (2 ESTs); SL_ROOT_pre-anthesis2 (2 ESTs); SL_PRERIP_FRUIT_TAMU (1 ESTs); SL_GFRUIT (1 ESTs); SL_FLOWERBUDS (1 ESTs); SL_Seedlings (1 ESTs); SL_MicroFRUIT (1 ESTs); SL_flower_anthesis (1 ESTs); SL_FLOWER (1 ESTs); |
| Sequence | GGAGAAACCAAAAAATAAATTAAAATGGCGATTACTACAAACAGTTCTAAGAGAGATATG |
| EST members of Unigene | SRR015435.27738 BI934347 BP893396 SRR015435.247394 SRR015435.224891 DB727420 AI771121 AW218933 SRR015435.252026 BI923050 SRR015435.211322 SRR015435.322249 AW932007 BI931182 DB685236 SRR015435.269561 AI483885 SRR015435.235440 AW622213 AW738652 FS202713 BE459523 SRR015435.142841 SRR015435.130257 SRR015435.318262 BI921363 BI422778 SRR015435.307587 SRR015435.88550 CK715123 DB697144 SRR015435.156340 SRR015435.227908 SRR015435.284501 DB693185 SRR015435.122084 BP881843 SRR015435.29427 AW034387 FS201926 SRR015435.299088 BP893066 BE450126 DB683135 BE450131 SRR015435.8026 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | MYB |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 836865 |
| Trichome-related Gene from Literature | 836865 |