| Detail of EST/Unigene TCSL74613 |
| Acc. | TCSL74613 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Ferric reduction oxidase 5 OS=Arabidopsis thaliana E-value=0; Ferric reduction oxidase 4 OS=Arabidopsis thaliana E-value=0; Ferric reduction oxidase 2 OS=Arabidopsis thaliana E-value=0; Probable ferric reduction oxidase 1 OS=Arabidopsis thaliana E-value=0; Ferric reduction oxidase 3, mitochondrial OS=Arabidopsis thaliana E-value=0; |
| Length | 1584 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_TAMU_CALLUS (38 ESTs); SL_CALLUS (10 ESTs); SL_ROOT (7 ESTs); SL_cTOS (6 ESTs); LIBEST_024426 (2 ESTs); SL_ROOT_DEF (1 ESTs); SRR015435 (1 ESTs); SL_ROOT_pre-anthesis2 (1 ESTs); |
| Sequence | GATAAGGAGAAAGATGTTCGATTTATTCTTCTACACACATCAACTATATACTCTATACAT |
| EST members of Unigene | AI896429 AW035107 AW035106 AW035105 AW035101 AW035100 BI922247 AW035903 FS193901 AI895657 AW032415 BI204495 BI922847 AW034366 AW035146 AW032766 BI922413 AW980096 SRR015435.323246 AW032716 BI923331 BE450195 AW031565 AW035448 AW621422 BI208090 AW030789 BI922384 AI894817 AW035460 AI896571 AW032551 AW217114 BI921590 AW034113 BI203983 AW035400 BI206302 AI895930 BI922335 AW035605 AW622362 AW030163 AW219799 AW219801 BI922544 BI921195 BI203822 BI422966 AW031704 BI922517 BI210489 AW035148 AW216830 AW035150 BI422149 AW030106 AW033027 AW030908 FS182536 AI896304 AW217070 BI421989 AW219180 AW219764 AW622330 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | 5.B.1 Phagocyte NADPH oxidase Gp91phox |
| Probeset |
|
| Corresponding NCBI Gene | 832464 |
| Trichome-related Gene from Literature | 832464 |