| Detail of EST/Unigene TCSL74712 |
| Acc. | TCSL74712 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Linoleate 9S-lipoxygenase A OS=Solanum lycopersicum E-value=0; Linoleate 9S-lipoxygenase 6 (Fragment) OS=Solanum tuberosum E-value=0; Probable linoleate 9S-lipoxygenase 4 OS=Solanum tuberosum E-value=0; Linoleate 9S-lipoxygenase 2 OS=Solanum tuberosum E-value=0; Probable linoleate 9S-lipoxygenase 8 OS=Solanum tuberosum E-value=0; |
| Length | 1549 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_maturing_fruit (5 ESTs); SL_germ_seedlings_TAMU (5 ESTs); SL_PRERIP_FRUIT_TAMU (4 ESTs); SL_breaker_fruit (4 ESTs); SL_flower_anthesis (2 ESTs); SL_GFRUIT (1 ESTs); SL_pericarp (1 ESTs); SL_TAMU_CALLUS (1 ESTs); |
| Sequence | CTGGATGGACTAACGATTGATGAGGCGATCAACAGTAATAAACTTTTCATATTGAACCAT |
| EST members of Unigene | AW650488 AW933639 BM410326 AW648903 AW650254 BP882534 AW647903 BE459909 BP877496 BP884829 BP892243 AW650298 BP891667 BM412563 AW931404 BI934827 BI934824 BM412709 AW933683 BI423111 BM412482 AW930440 CD002405 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00461 arachidonate 5-lipoxygenase; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K00461 arachidonate 5-lipoxygenase; ; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K08022 arachidonate 15-lipoxygenase (second type) / 8-lipoxygenase (S-type) |
| EC | 1.13.11.- 1.13.11.33 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 841944 |
| Trichome-related Gene from Literature | 841944 |