Detail of EST/Unigene TCSL74838 |
Acc. | TCSL74838 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Cycloartenol-C-24-methyltransferase 1 OS=Oryza sativa subsp. japonica E-value=0; Cycloartenol-C-24-methyltransferase OS=Arabidopsis thaliana E-value=0; Probable cycloartenol-C-24-methyltransferase 1 OS=Dictyostelium discoideum E-value=4e-94; Sterol 24-C-methyltransferase OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=6e-85; Sterol 24-C-methyltransferase OS=Candida glabrata (strain ATCC 2001 / CBS 138 / JCM 3761 / NBRC 0622 / NRRL Y-65) E-value=4e-84; |
Length | 1499 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015436 (7 ESTs); SRR015435 (6 ESTs); SL_FRUIT (5 ESTs); SL_CELL_BTI (3 ESTs); SL_breaker_fruit (3 ESTs); SL_GFRUIT (2 ESTs); LIBEST_024426 (2 ESTs); SL_TAMU_CALLUS (1 ESTs); SL_CDS (1 ESTs); SL_PRERIP_FRUIT_TAMU (1 ESTs); SL_radicle (1 ESTs); SL_RES (1 ESTs); SL_TAMU (1 ESTs); SL_germ_seedlings_TAMU (1 ESTs); SL_flower_anthesis (1 ESTs); SL_CROWNGALL (1 ESTs); SL_ROOT (1 ESTs); SL_flowerbuds4 (1 ESTs); SL_SHOOT_4WEEK (1 ESTs); |
Sequence | GGCGTATATATATATATGAGTTGTTGCTGTAGTTGTTTACAGCATATTTGCTTTTTCTAA |
EST members of Unigene | FS198335 BF112345 SRR015435.103191 BE433930 BT013908 AW216799 SRR015436.285251 AW735808 AW220252 AW651242 SRR015435.274574 SRR015435.36348 BF051898 BM409299 AW093072 SRR015435.179238 SRR015436.18696 SRR015436.275089 AW218374 BE458625 BM410938 AW037870 BG128206 AI775101 BI933287 BE432949 BE431705 AW933748 AW037420 SRR015436.153522 SRR015435.190617 AI490067 SRR015436.77524 BE431451 BG135173 FS202552 SRR015436.78155 SRR015435.200350 SRR015436.113333 BE435928 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 831216 |
Trichome-related Gene from Literature | 831216 |