Detail of EST/Unigene TCSL74942 |
Acc. | TCSL74942 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | V-type proton ATPase subunit C OS=Arabidopsis thaliana E-value=0; V-type proton ATPase subunit C OS=Hordeum vulgare E-value=0; V-type proton ATPase subunit C 1-A OS=Danio rerio E-value=6e-69; V-type proton ATPase subunit C 1-B OS=Danio rerio E-value=2e-68; V-type proton ATPase subunit C OS=Manduca sexta E-value=8e-68; |
Length | 1462 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015435 (21 ESTs); SRR015436 (16 ESTs); SL_TAMU_CALLUS (4 ESTs); LIBEST_024426 (4 ESTs); SL_ROOT (3 ESTs); SL_MicroLEAF3 (2 ESTs); SL_flower_anthesis (2 ESTs); SL_RIP_FRUIT_TAMU (2 ESTs); SL_GFRUIT (2 ESTs); SL_flower_buds4 (2 ESTs); SL_Lyc_leaf (2 ESTs); SL_germ_seedlings_TAMU (1 ESTs); SL_TRI (1 ESTs); SL_MicroFRUIT2 (1 ESTs); SL_breaker_fruit (1 ESTs); SL_RES (1 ESTs); SL_flowerbuds4 (1 ESTs); SL_FLOWER_DEV (1 ESTs); SL_ROOT_pre-anthesis2 (1 ESTs); SL_DEF_ROOT (1 ESTs); SL_PRERIP_FRUIT_TAMU (1 ESTs); SL_MicroFRUIT (1 ESTs); SL_radicle (1 ESTs); SL_CALLUS (1 ESTs); SL_CROWNGALL (1 ESTs); SL_maturing_fruit (1 ESTs); SL_FLOWERBUDS (1 ESTs); SL_SHOOT_4WEEK (1 ESTs); |
Sequence | GGGGGACTAAAAAGTTCAACGACTCGTATTTCTATCTTCCTTTGCATCTAATCAATCAAA |
EST members of Unigene | BW686932 SRR015436.138650 SRR015435.171201 BE353767 SRR015435.254396 AW441495 AI775384 SRR015436.69883 FS179227 SRR015436.314008 SRR015436.166613 BP885679 SRR015435.105680 AW442287 SRR015436.308095 BI929206 ES893156 DB709627 SRR015436.157466 SRR015436.235347 BP901242 BG630369 BE458722 BE458724 SRR015435.5419 SRR015435.291444 BE451373 AW034296 BP898753 SRR015435.2482 SRR015435.50489 SRR015436.128987 SRR015435.217169 SRR015435.264691 SRR015436.293957 SRR015435.264298 FS194138 FS194357 AW429076 AI895957 AW930012 BI928882 AW621952 BG643163 AW649787 SRR015435.326578 SRR015436.115828 SRR015435.301185 FS190756 SRR015435.112362 SRR015436.159767 SRR015436.99820 AW031924 SRR015435.67222 SRR015436.157925 BI936013 AW622379 BM535168 SRR015435.324276 AW218960 DB701917 SRR015435.280117 SRR015435.242530 SRR015436.252934 DB682746 SRR015435.157577 AW034561 BF097110 SRR015436.287519 BI923461 SRR015436.204908 BG134798 BI934023 SRR015435.182857 SRR015435.152512 AW626301 SRR015435.288241 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Energy Metabolism > ko00190 Oxidative phosphorylation > K02148 V-type H+-transporting ATPase subunit C |
EC | 3.6.3.14 |
Transcription Factor Family | |
Transporter Classification Family | 3.A.2 H+- or Na+-translocating F-type, V-type and A-type ATPase superfamily F-ATPase |
Probeset |
|
Corresponding NCBI Gene | 837840 |
Trichome-related Gene from Literature | 837840 |