Detail of EST/Unigene TCSL74999 |
Acc. | TCSL74999 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Mannose-1-phosphate guanylyltransferase 1 OS=Arabidopsis thaliana E-value=0; Probable mannose-1-phosphate guanylyltransferase 3 OS=Oryza sativa subsp. japonica E-value=0; Probable mannose-1-phosphate guanylyltransferase 1 OS=Oryza sativa subsp. japonica E-value=0; Probable mannose-1-phosphate guanylyltransferase 2 OS=Oryza sativa subsp. japonica E-value=0; Probable mannose-1-phosphate guanylyltransferase 2 OS=Arabidopsis thaliana E-value=0; |
Length | 1443 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015435 (10 ESTs); SL_MicroLEAF3 (7 ESTs); SL_FRUIT (4 ESTs); SL_FLOWER (3 ESTs); SL_SHOOT_4WEEK (3 ESTs); SL_PRERIP_FRUIT_TAMU (3 ESTs); SL_Lyc_leaf (2 ESTs); SL_FLOWERBUDS (2 ESTs); SL_breaker_fruit (2 ESTs); SL_MicroFRUIT2 (2 ESTs); SL_TAMU_CALLUS (2 ESTs); SRR015436 (2 ESTs); SL_FLOWERBUDS3 (2 ESTs); SL_TAMU (2 ESTs); SL_CELL_BTI (2 ESTs); SL_maturing_fruit (2 ESTs); LIBEST_024426 (1 ESTs); SL_flower_buds8 (1 ESTs); SL_CROWNGALL (1 ESTs); SL_flower_buds4 (1 ESTs); SL_flower_buds3 (1 ESTs); SL_ROOT (1 ESTs); SL_SUS_LEAF (1 ESTs); SL_flower_anthesis (1 ESTs); SL_CDS (1 ESTs); SL_cTOS (1 ESTs); SL_DEF_ROOT (1 ESTs); SL_TRI (1 ESTs); SL_RIP_FRUIT_TAMU (1 ESTs); SL_GFRUIT (1 ESTs); |
Sequence | GTCTAGGCTTTTCTACAACACAACCCGACCGTCACTGTTTGTGATCTATCAATATTTTGC |
EST members of Unigene | BI932587 SRR015435.23084 BT014503 DB685619 FS197406 DB693268 SRR015435.121010 BE460244 SRR015436.192065 BI926905 DB693295 BI932420 DB689289 SRR015436.153382 AW222790 AI899209 SRR015435.41953 BE354838 BE354839 AW623911 AW932795 AW933464 AW219524 DB704769 AW033893 BW687069 BM413164 BE433693 SRR015435.272653 BG131604 AI781999 BG130559 BI207297 AW034231 BI933671 ES892894 DB680491 BP897153 AI486774 SRR015435.2531 AW094217 AW737633 AW737634 BG127452 AW931210 BI929684 BF113260 BF097530 BP887673 AW094731 BI932250 SRR015435.155428 BF051315 SRR015435.211644 BE435169 DB680353 SRR015435.226596 BP877617 SRR015435.148421 BW692575 BE460594 SRR015435.27263 BP897705 BG130310 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00051 Fructose and mannose metabolism > K00966 mannose-1-phosphate guanylyltransferase; Metabolism > Carbohydrate Metabolism > ko00051 Fructose and mannose metabolism > K00971 mannose-1-phosphate guanylyltransferase |
EC | 2.7.7.13 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818562 |
Trichome-related Gene from Literature | 818562 |