Detail of EST/Unigene TCSL75366 |
Acc. | TCSL75366 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Syntaxin-132 OS=Arabidopsis thaliana E-value=0; Putative syntaxin-131 OS=Arabidopsis thaliana E-value=0; Syntaxin-121 OS=Arabidopsis thaliana E-value=3e-60; Syntaxin-125 OS=Arabidopsis thaliana E-value=2e-59; Syntaxin-123 OS=Arabidopsis thaliana E-value=5e-59; |
Length | 1329 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015435 (16 ESTs); SRR015436 (8 ESTs); LIBEST_024426 (2 ESTs); SL_MicroLEAF3 (2 ESTs); SL_CELL_BTI (1 ESTs); SL_CROWNGALL (1 ESTs); SL_CDS (1 ESTs); SL_PRERIP_FRUIT_TAMU (1 ESTs); SL_maturing_fruit (1 ESTs); SL_flower_buds8 (1 ESTs); SL_MicroFRUIT2 (1 ESTs); SL_FLOWER_DEV (1 ESTs); SL_FRUIT (1 ESTs); |
Sequence | CCTTTCTGCCTCCCTCTTTCTCTCTCTAAAAATTGTTCAAAGGGGTCGAAGCAGAAACTA |
EST members of Unigene | SRR015436.319134 BG132040 SRR015436.315227 SRR015435.52201 SRR015435.102201 SRR015435.339248 SRR015435.56442 SRR015436.293108 FS191851 SRR015435.111522 SRR015436.204789 SRR015436.48253 SRR015435.16488 BT013221 BW689849 BE433287 BG734745 SRR015435.103341 SRR015435.209519 SRR015436.105254 AW622927 SRR015435.18674 SRR015435.176337 SRR015435.62775 AW930801 DB699653 SRR015436.186188 SRR015436.166990 AW092025 BP888817 SRR015435.222927 SRR015435.19524 SRR015435.239030 FS204960 DB701436 SRR015435.232999 SRR015435.232610 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Folding, Sorting and Degradation > ko04130 SNARE interactions in vesicular transport > K04560 syntaxin 1A |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830702 |
Trichome-related Gene from Literature | 830702 |