| Detail of EST/Unigene TCSL75477 |
| Acc. | TCSL75477 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Farnesyl pyrophosphate synthase 1 OS=Lupinus albus E-value=0; Farnesyl diphosphate synthase 1 OS=Artemisia spiciformis E-value=0; Farnesyl pyrophosphate synthase 2 OS=Parthenium argentatum E-value=0; Farnesyl pyrophosphate synthase 2 OS=Lupinus albus E-value=0; Farnesyl pyrophosphate synthase OS=Artemisia annua E-value=0; |
| Length | 1302 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435 (33 ESTs); SRR015436 (29 ESTs); SL_MicroLEAF3 (7 ESTs); SL_TAMU (4 ESTs); SL_breaker_fruit (4 ESTs); SL_FLOWER (3 ESTs); SL_flower_buds3 (3 ESTs); SL_cTOS (2 ESTs); SL_CROWNGALL (2 ESTs); SL_FLOWERBUDS3 (2 ESTs); SL_maturing_fruit (2 ESTs); SL_CDS (2 ESTs); SL_flower_buds8 (2 ESTs); SL_MicroFRUIT (2 ESTs); SL_FRUIT (2 ESTs); SL_flowerbuds4 (1 ESTs); SL_ROOT (1 ESTs); LIBEST_024457 (1 ESTs); SL_flower_buds4 (1 ESTs); SL_CALLUS (1 ESTs); |
| Sequence | GGCCATTACGGCCGGGGAACCTCAGATCTCTTCCTTCTCTGTTTATATATACATAAACTT |
| EST members of Unigene | BE463091 SRR015435.87866 SRR015436.25775 BE463088 SRR015436.210978 SRR015436.29323 SRR015436.13702 DB698037 BI932987 BE462752 BT013910 SRR015435.290417 SRR015435.6137 SRR015435.241586 SRR015435.48878 DB705964 SRR015435.67115 BG135342 SRR015436.272013 DB687017 SRR015436.321148 BE460920 BM412843 SRR015436.158230 SRR015436.122688 SRR015435.130688 SRR015436.214523 BI923582 SRR015435.304809 SRR015436.121687 SRR015435.79975 AI485064 SRR015435.282343 SRR015435.16711 SRR015436.11763 BP879418 BI925486 SRR015435.312203 SRR015435.212704 BI924548 AF048747 SRR015436.194285 SRR015436.104872 SRR015436.28679 GO374902 AW219383 BM409525 AW623555 SRR015436.169076 SRR015435.171424 BM408552 SRR015436.118537 DB704749 SRR015436.191297 SRR015435.118197 DB685375 DB724398 SRR015436.103926 SRR015435.189254 SRR015435.174415 SRR015436.261811 SRR015435.201708 SRR015435.145332 SRR015435.165106 SRR015435.322116 SRR015436.132394 AI489905 SRR015435.159239 DB724599 BI931552 SRR015436.46531 BE461011 BI930772 SRR015436.71951 SRR015436.165696 BM412544 SRR015436.61123 SRR015435.166468 AW944754 DB698382 SRR015435.191435 SRR015435.290968 DB705508 SRR015435.264046 AI898497 BI206826 BI923045 SRR015435.202528 SRR015435.138780 SRR015435.128723 AI488474 SRR015435.124632 SRR015436.204921 SRR015435.299083 BP880507 SRR015435.65725 SRR015436.128891 BI928858 SRR015436.64696 SRR015436.230384 SRR015435.250072 SRR015436.291556 BI205294 BG132277 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00900 Terpenoid biosynthesis > K00787 dimethylallyltranstransferase; Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K00787 dimethylallyltranstransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00900 Terpenoid biosynthesis > K00795 geranyltranstransferase; Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K00795 geranyltranstransferase |
| EC | 2.5.1.1 2.5.1.10 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827430 |
| Trichome-related Gene from Literature | 827430 |