| Detail of EST/Unigene TCSL75539 |
| Acc. | TCSL75539 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Cell division control protein 2 homolog A OS=Antirrhinum majus E-value=0; Cell division control protein 2 homolog OS=Chenopodium rubrum E-value=0; Cell division control protein 2 homolog OS=Vigna aconitifolia E-value=0; Cell division control protein 2 homolog OS=Vigna unguiculata E-value=0; Cell division control protein 2 homolog 1 (Fragment) OS=Medicago sativa E-value=0; |
| Length | 1281 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435 (9 ESTs); SRR015436 (7 ESTs); SL_CELL_BTI (5 ESTs); LIBEST_024426 (5 ESTs); SL_maturing_fruit (3 ESTs); SL_MicroLEAF3 (2 ESTs); SL_SHOOT_4WEEK (2 ESTs); SL_DROOT (1 ESTs); SL_CDS (1 ESTs); SL_germ_seedlings_TAMU (1 ESTs); SL_flower_anthesis (1 ESTs); SL_TAMU_CALLUS (1 ESTs); SL_GFRUIT (1 ESTs); |
| Sequence | CCATTACGGCCGGGGGTTTCCCTGTGGTACAACTACAACAGCAGTTACTCCGTCTCCGCC |
| EST members of Unigene | SRR015435.258288 SRR015436.305429 BP881209 SRR015435.160518 FS179358 BI935705 SRR015436.291180 SRR015436.47983 FS195234 SRR015435.163073 FS203902 BP883278 SRR015435.206511 AW094243 FS189374 SRR015436.156890 SRR015435.230585 SRR015436.243146 BE441050 SRR015436.166819 SRR015435.359832 AW650158 SRR015436.113548 DB689736 AW031117 AW093022 BG128226 BP882105 AW039674 EG553349 Y17226 DB700174 AW093367 SRR015435.259975 FS187535 SRR015435.107971 BG643319 SRR015435.51768 AW092602 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 2.7.1.- 2.7.11.22 |
| Transcription Factor Family | WRKY |
| Transporter Classification Family | 1.A.2 Animal inward-rectifier K+ channel IRK-C; 1.A.26 Plant plasmodesmata PPD |
| Probeset |
|
| Corresponding NCBI Gene | 824036 |
| Trichome-related Gene from Literature | 824036 |