Detail of EST/Unigene TCSL76550 |
Acc. | TCSL76550 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Rac-like GTP-binding protein ARAC1 OS=Arabidopsis thaliana E-value=0; Rac-like GTP-binding protein RHO1 OS=Beta vulgaris E-value=0; Rac-like GTP-binding protein ARAC11 OS=Arabidopsis thaliana E-value=0; Rac-like GTP-binding protein ARAC6 OS=Arabidopsis thaliana E-value=0; Rac-like GTP-binding protein RHO1 OS=Pisum sativum E-value=6e-99; |
Length | 1081 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015436 (6 ESTs); SL_breaker_fruit (5 ESTs); SL_GFRUIT (3 ESTs); SRR015435 (2 ESTs); SL_MicroLEAF3 (2 ESTs); SL_FRUIT (2 ESTs); SL_FLOWERBUDS (1 ESTs); SL_SUS_LEAF (1 ESTs); |
Sequence | TGTGAAGAACGGTTCAACGGCATAATTTTGCGGCTAAAAAATGCGAGCCATAATATAATG |
EST members of Unigene | BM413379 BE436919 SRR015435.354021 BF051950 SRR015436.83925 AI778114 BE460109 AW738459 DB701340 BM536003 BF051295 BE461146 BM411598 DB700615 SRR015435.106954 SRR015436.41644 SRR015436.40533 BM534986 BM413293 SRR015436.56746 SRR015436.76624 SRR015436.64044 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | 9.A.5 Peroxisomal protein importer PPI |
Probeset |
|
Corresponding NCBI Gene | 816290 |
Trichome-related Gene from Literature | 816290 |