| Detail of EST/Unigene TCSL76550 |
| Acc. | TCSL76550 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Rac-like GTP-binding protein ARAC1 OS=Arabidopsis thaliana E-value=0; Rac-like GTP-binding protein RHO1 OS=Beta vulgaris E-value=0; Rac-like GTP-binding protein ARAC11 OS=Arabidopsis thaliana E-value=0; Rac-like GTP-binding protein ARAC6 OS=Arabidopsis thaliana E-value=0; Rac-like GTP-binding protein RHO1 OS=Pisum sativum E-value=6e-99; |
| Length | 1081 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015436 (6 ESTs); SL_breaker_fruit (5 ESTs); SL_GFRUIT (3 ESTs); SL_MicroLEAF3 (2 ESTs); SL_FRUIT (2 ESTs); SRR015435 (2 ESTs); SL_FLOWERBUDS (1 ESTs); SL_SUS_LEAF (1 ESTs); |
| Sequence | TGTGAAGAACGGTTCAACGGCATAATTTTGCGGCTAAAAAATGCGAGCCATAATATAATG |
| EST members of Unigene | BM413379 BE436919 SRR015435.354021 BF051950 SRR015436.83925 AI778114 BE460109 AW738459 DB701340 BM536003 BF051295 BE461146 BM411598 DB700615 SRR015435.106954 SRR015436.41644 SRR015436.40533 BM534986 BM413293 SRR015436.56746 SRR015436.76624 SRR015436.64044 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1 |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | 9.A.5 Peroxisomal protein importer PPI |
| Probeset |
|
| Corresponding NCBI Gene | 816290 |
| Trichome-related Gene from Literature | 816290 |