| Detail of EST/Unigene TCSL76995 |
| Acc. | TCSL76995 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=0; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=0; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=0; |
| Length | 1019 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_Lyc_leaf (48 ESTs); SL_SHOOT_4WEEK (28 ESTs); SL_CELL_BTI (19 ESTs); SL_RES (13 ESTs); SL_FLOWER_DEV (11 ESTs); SL_maturing_fruit (10 ESTs); SL_SUS_LEAF (8 ESTs); SL_MicroLEAF3 (8 ESTs); SL_MicroFRUIT2 (7 ESTs); SRR015435 (6 ESTs); SRR015436 (5 ESTs); SL_germ_seedlings_TAMU (2 ESTs); SL_flower_buds8 (2 ESTs); SL_CROWNGALL (2 ESTs); SL_FLOWERBUDS (2 ESTs); SL_CDS (2 ESTs); SL_TRI (2 ESTs); SL_Seedlings (1 ESTs); SL_flowerbuds4 (1 ESTs); SL_FLOWERBUDS3 (1 ESTs); SL_FLOWER (1 ESTs); SL_ROOT_TRANSGENIC (1 ESTs); SL_flower_buds3 (1 ESTs); SL_flower_buds4 (1 ESTs); |
| Sequence | GATCACCCATCAAACACTTAATTCTTCTCTTAAAATAAACACAAATGGCAGCTGCTACAA |
| EST members of Unigene | BP903608 BG125207 DB700672 BG132022 AW651057 AW651058 BG643258 BP889895 DB700138 BP883324 AW442759 BI932002 BG629062 BP897615 AW037763 AW094480 BG643830 AI772475 TOMCBPA AW217758 BG129837 AW040712 BG631197 DB697230 SRR015436.43318 BG125809 BP898418 BP905373 BG626776 BG127164 BP904989 BG126793 AW037602 BP901314 BG128897 BP906320 SRR015435.214817 BP902075 AI782431 BP901886 AI774323 AW442780 AI774324 BG125421 AI774832 BG128483 AW096713 BG643019 DB701544 BP902410 AI772634 BP902799 BG643025 BG124494 BP879237 BP902029 AW041438 BP901635 BG126505 BP903557 AI777217 BG128245 SRR015435.322857 AW041433 BP890237 AI776502 BW692630 BP900873 AI776908 BP900100 BP892966 BW691860 BP905136 BG644023 BE354320 AW037465 BP889103 BP906683 BP908038 AI779673 BP904554 AW443121 BG642533 SRR015436.175101 BP903391 BG130009 BG642653 BG126729 BP897018 BP900303 BP906884 BG629342 AI774710 AW040419 BT014208 BP899847 BG132899 DB699425 BG643752 BG629758 AW623875 BP902165 BG631672 SRR015436.200675 BP900406 BG130116 BE462625 BG130505 ES894456 BG126456 BG643542 DB706893 BP899473 AW094016 BP906428 BP905280 BP904122 BI925276 AW040835 BW689818 BG627848 SRR015436.3620 BP882689 BG628046 AW040639 BG629579 AI775690 CK715124 BP902761 DB708874 AW442494 BP898128 BP901995 BG626488 BP904120 BP908383 AI775269 BP910982 BP888390 BP902109 SRR015436.20410 AI779935 BP895930 AW038404 SRR015435.88027 CK468700 BW690341 BP904035 ES893995 AI782256 BW685179 AI781672 BI928240 AI773871 AI779342 AI775419 AI778563 AW442994 AI777998 DB707473 BG630091 BP883593 BP905035 BP901560 AW623255 SRR015435.267507 BP901564 BG126252 BG642757 BP903111 AW443811 BG642941 BP875861 BP897680 BP903862 BW685802 BW692938 BP901740 SRR015435.122305 SRR015435.219811 BP896332 BG123152 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839871 |
| Trichome-related Gene from Literature | 839871 |