Detail of EST/Unigene TCSL77011 |
Acc. | TCSL77011 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase OS=Hyoscyamus muticus E-value=2e-50; Glutathione S-transferase F8, chloroplastic OS=Arabidopsis thaliana E-value=3e-50; Glutathione S-transferase F11 OS=Arabidopsis thaliana E-value=1e-49; Glutathione S-transferase F9 OS=Arabidopsis thaliana E-value=2e-49; Glutathione S-transferase PARB OS=Nicotiana tabacum E-value=1e-48; |
Length | 1022 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015435 (12 ESTs); SRR015436 (8 ESTs); SL_MicroLEAF3 (4 ESTs); LIBEST_024426 (3 ESTs); SL_cTOS (3 ESTs); SL_Lyc_leaf (2 ESTs); SL_pericarp (1 ESTs); SL_maturing_fruit (1 ESTs); SL_MicroFRUIT2 (1 ESTs); SL_FRUIT (1 ESTs); SL_CROWNGALL (1 ESTs); SL_SHOOT_4WEEK (1 ESTs); SL_breaker_fruit (1 ESTs); SL_FLOWERBUDS3 (1 ESTs); |
Sequence | GGCCATTACGGCCGGGGGATTTTCCGATGGCTACTCCGGTGAAAGTGTACGGACCAACTT |
EST members of Unigene | CD002179 FS202817 BP902074 FS200078 SRR015435.35884 SRR015435.47531 SRR015436.155413 BI208928 SRR015436.73616 BM413395 SRR015435.144071 SRR015436.155901 BE354836 SRR015435.318594 DB692718 DB678777 BG135663 BI208101 BG128094 SRR015435.346812 DB683667 BI207251 SRR015435.281623 SRR015436.130938 SRR015436.293183 BP901994 BW690411 BE434050 SRR015436.270616 SRR015435.249466 SRR015436.327150 SRR015435.225424 SRR015435.96562 SRR015435.242729 SRR015435.359623 FS195594 DB702301 BP875863 SRR015436.125540 SRR015435.171127 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
EC | 2.5.1.18 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 819386 |
Trichome-related Gene from Literature | 819386 |