Detail of EST/Unigene TCSL77224 |
Acc. | TCSL77224 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Probable calcium-binding protein CML35 OS=Arabidopsis thaliana E-value=5e-30; Probable calcium-binding protein CML36 OS=Arabidopsis thaliana E-value=2e-28; Calmodulin-like protein 5 OS=Arabidopsis thaliana E-value=2e-17; Calmodulin-like protein 4 OS=Arabidopsis thaliana E-value=2e-17; Probable calcium-binding protein CML18 OS=Oryza sativa subsp. japonica E-value=3e-16; |
Length | 983 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015435 (9 ESTs); SL_PAMP (9 ESTs); SL_TAMU (5 ESTs); SL_MicroLEAF3 (4 ESTs); SRR015436 (3 ESTs); SL_FRUIT (3 ESTs); SL_CROWNGALL (3 ESTs); SL_SHOOT_4WEEK (2 ESTs); LIBEST_025266 (2 ESTs); SL_CALLUS (2 ESTs); SL_maturing_fruit (2 ESTs); SL_MicroFRUIT2 (1 ESTs); SL_RES (1 ESTs); SL_RIP_FRUIT_TAMU (1 ESTs); SL_CELL_BTI (1 ESTs); SL_TAMU_CALLUS (1 ESTs); SL_ROOT_TRANSGENIC (1 ESTs); SL_PRERIP_FRUIT_TAMU (1 ESTs); SL_SUS_LEAF (1 ESTs); |
Sequence | ATACTCTTCTTAATCTTTTTCTCTCTCTAAGAAGCTTCCTCGAAGCTTAGTAATGGAGTC |
EST members of Unigene | SRR015436.154029 AI486285 SRR015435.48323 AI485314 GH622627 BE434339 BG643865 GH622630 GH622632 GH622640 AI490268 GH622644 BG124826 BI923002 AI777496 AW094645 DB701540 SRR015435.331388 AI490371 BG135657 SRR015435.358535 AW222333 SRR015436.148965 BW689279 SRR015435.321460 AI485629 DB688254 DB689343 SRR015435.137763 SRR015435.33086 BP891156 BG133279 SRR015435.130982 AI773361 BE460807 SRR015435.33839 GT165358 BG131378 BP891530 SRR015435.360576 GH622647 SRR015436.308274 GT164539 GH622652 GH622653 DB690152 GH622655 CK468714 BE431458 AW930468 AW030515 BI922307 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04020 Calcium signaling pathway > K02183 calmodulin; Environmental Information Processing > Signal Transduction > ko04070 Phosphatidylinositol signaling system > K02183 calmodulin |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818739 |
Trichome-related Gene from Literature | 818739 |