Detail of EST/Unigene TCSL77489 |
Acc. | TCSL77489 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=0; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=0; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=0; |
Length | 951 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_Lyc_leaf (42 ESTs); SL_CELL_BTI (39 ESTs); SL_RES (28 ESTs); SL_FLOWER_DEV (19 ESTs); SL_SHOOT_4WEEK (17 ESTs); SL_SUS_LEAF (11 ESTs); SL_FLOWERBUDS3 (6 ESTs); SL_MicroLEAF3 (6 ESTs); SRR015436 (4 ESTs); SRR015435 (4 ESTs); SL_Seedlings (4 ESTs); SL_FLOWER (3 ESTs); SL_flower_buds4 (3 ESTs); SL_flower_anthesis (2 ESTs); SL_SHOOT_8WEEK (2 ESTs); SL_flower_buds8 (2 ESTs); SL_flowerbuds4 (1 ESTs); SL_FLOWERBUDS (1 ESTs); SL_MicroFRUIT2 (1 ESTs); |
Sequence | GCAGCAAACTTCAAAAGTTTACCATCAAACACTTACTTTTCTCTTGATATAAACACAATG |
EST members of Unigene | AI774068 DB701033 AI780111 BG643960 AW093947 AI772125 BP902605 AI776424 SRR015435.108031 AI775640 AW442616 SRR015436.74139 AI780106 BG735084 BI933214 AI775617 AW093930 AI773281 BG126241 BG128966 BP896748 BG627400 AW093139 AW442630 BP909620 BG627445 AI482991 BG126304 AW038813 BP906159 BG625912 AW041562 AI774914 BP910060 BP896431 BP903413 BI931189 BG735126 BP896382 BP911180 BP898720 AI776826 AI775658 AI772540 AI778180 BP896786 DB688682 BG628252 AW442591 AW038242 BG628101 BP897840 BG627323 BG628494 AI779250 BG735032 AW094661 DB697644 AW041814 AI774386 AW094246 AW041803 BI933908 AI772017 AI782759 CK714847 CK714836 BP900552 CK714832 BP898610 AW623137 BG124510 BP906027 BP898631 AW217861 BG626970 AW217862 AW217863 SRR015436.142359 BG628925 BP895939 AW092717 BG124660 BP903734 AW039886 AW443350 BP896297 BP901751 AI774002 BP902143 CK715101 BP900584 AI772058 BP898647 BP900205 AI490712 DB681474 AW092824 AW442802 BG643787 SRR015435.307274 BE353172 AW038179 AW442845 BG127548 AW039776 BP898934 BP896989 AI779567 SRR015436.86677 BI931757 BP905114 AI781476 SRR015436.177385 AI773087 AW039740 BW687491 BG630340 BP896185 AW037380 BP897357 BP903612 AI773918 AI778019 AI781554 BP897021 AW929377 BG124188 AW093433 BP899757 AW039431 DB695158 AI779613 BG126120 AW096490 BP899721 BP898164 AI775871 BG123770 AI777192 BP902067 SRR015435.331075 BP903627 AW039797 AW094591 BG129646 BI930947 BG629815 AI772999 AW096722 BP911264 BE463100 SRR015435.139166 BP901150 AW091588 BG644068 BP901935 BG126767 DB701320 AW623711 BG627480 AW929576 BI929916 AI774148 AI775710 AW738478 AW039628 BG125169 BG126337 BG123619 AW037681 AI774578 AW092507 BG631060 BI929993 AI774307 AW040566 AW039701 BP901986 AW039715 BP903161 BG627194 BG630669 BI929986 AW735853 AI773416 AI774589 AI774983 BP910908 AI774597 AW094078 BG629881 AI774293 AW092189 AI777506 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |