Detail of EST/Unigene TCSL84814 |
Acc. | TCSL84814 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase, chloroplastic OS=Catharanthus roseus E-value=3e-26; 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase, chloroplastic OS=Arabidopsis thaliana E-value=6e-24; 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-23; 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase OS=Hahella chejuensis (strain KCTC 2396) E-value=5e-15; 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase OS=Alcanivorax borkumensis (strain SK2 / ATCC 700651 / DSM 11573) E-value=1e-14; |
Length | 159 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015435 (17 ESTs); SRR015436 (1 ESTs); |
Sequence | TTGGTGGGATTAATATTCCTCATGATAGAGGCTGTGAAGCTCACTCTGATGGTGACGTTT |
EST members of Unigene | SRR015435.131446 SRR015435.72184 SRR015436.137636 SRR015435.198293 SRR015435.343928 SRR015435.175691 SRR015435.28355 SRR015435.271511 SRR015435.341576 SRR015435.314831 SRR015435.121273 SRR015435.254668 SRR015435.66066 SRR015435.224040 SRR015435.205774 SRR015435.249504 SRR015435.286324 SRR015435.156028 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842700 |
Trichome-related Gene from Literature | 842700 |