| Detail of Probeset Msa.2525.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Msa.2525.1.S1_s_at |
| Species | Medicago sativa |
| Annotation | iMsa.2525 /TID=Msa.2525.1 /CNT=1 /FEA=mRNA /TIER=ConsEnd /STK=0 /NOTE=sequence(s) not in UniGene /DEF= |
| Mapped public sequence ID | gi|166381|gb|K03282.1|ALFGS |
| Gene Ontology | GO:0004356 GO:0005634 GO:0005737 GO:0005829 GO:0006417 GO:0006542 GO:0006807 GO:0009117 GO:0019740 GO:0043094 GO:0005575 GO:0006538 GO:0007416 GO:0045213 |
| KEGG | K01915 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMS40851 TCMT42618 BQ151549 |
| Target sequence | cattgctgcttatggagaaggcaacgagcgtagattgacagggcgacatgagacagctga |