| Detail of EST/Unigene TCMT42618 |
| Acc. | TCMT42618 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutamine synthetase cytosolic isozyme OS=Medicago sativa E-value=0; Glutamine synthetase nodule isozyme OS=Vigna aconitifolia E-value=0; Glutamine synthetase cytosolic isozyme OS=Lotus japonicus E-value=0; Glutamine synthetase PR-1 OS=Phaseolus vulgaris E-value=0; Glutamine synthetase cytosolic isozyme 1 OS=Glycine max E-value=0; |
| Length | 1458 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBC_GLOMUS (7 ESTs); MT_SEEDROOT_KV3 (6 ESTs); MT_ROOTPHOS (5 ESTs); MT_DSTEM2 (5 ESTs); MT_JCVI-MT1 (5 ESTs); MtBA (4 ESTs); MHRP-root (4 ESTs); MT_NOD_GVN (3 ESTs); MT_SROOT_KV1 (3 ESTs); MT_NOD_ROOT (2 ESTs); MT_MGHG (2 ESTs); MT_IROOT_DSIR (2 ESTs); MT_SROOT_KV2 (2 ESTs); MT_HOGA (2 ESTs); MT_CDS (1 ESTs); MtSNF (1 ESTs); MT_Shoots (1 ESTs); MT_SROOT_KV0 (1 ESTs); MT_ECELL (1 ESTs); MT_PhoLEAF (1 ESTs); MT_SIRRA (1 ESTs); MT_FLOSEED_MTY (1 ESTs); |
| Sequence | GCTCTCTCTATTCACAATATTTCCGTTTTGATTTTCATTTGATTCATTCATTGAATCAAA |
| EST members of Unigene | Y10268 AL387610 AL387609 AL387012 AL385200 AL385199 AL383901 AL383900 AW561050 AW560433 CX523877 AW693957 AW692506 AW691867 AW693174 AW687975 BF648166 EV262543 EV261799 EV261550 EV260517 EV260177 DW018992 BG582429 BG581890 AW980526 BG448705 AW685199 AW329553 AW329430 AW328951 AW328944 AW125915 BG588620 BG588115 BE240766 BE240235 CB892332 BG645439 BG645432 BG645129 BG644628 AW774239 AJ845602 BM780213 BM780131 BE203887 BG457455 BQ154107 CB895184 CB894791 BF003555 BF003408 BE203115 AL369082 AL366172 AL366171 AL365998 BE943139 BE941025 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Energy Metabolism > ko00910 Nitrogen metabolism > K01915 glutamine synthetase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01915 glutamine synthetase; Metabolism > Glycan Biosynthesis and Metabolism > ko00550 Peptidoglycan biosynthesis > K01915 glutamine synthetase; Environmental Information Processing > Signal Transduction > ko02020 Two-component system > K01915 glutamine synthetase |
| EC | 6.3.1.2 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.2525.1.S1_s_at, Msa.3145.1.S1_at, Msa.3145.1.S1_s_at, Mtr.22927.1.S1_at
|
| Corresponding NCBI Gene | 833738 |
| Trichome-related Gene from Literature | N/A |