| Detail of Probeset Mtr.37311.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.37311.1.S1_at |
| Species | Medicago truncatula |
| Annotation | TC100381 /FEA=mRNA /DEF=similar to PIR|S16294|S16294 chlorophyll a/b-binding protein type I precursor - tomato {Lycopersicon esculentum;} , partial (90%) |
| Mapped public sequence ID | TC100381 |
| Gene Ontology | GO:0009503 GO:0009765 GO:0016168 |
| KEGG | K08912 K08916 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMS40196 TCMS40198 TCMS40197 TCMT40040 BQ154078 BG457482 |
| Target sequence | cttggtgctgctggattcatcattcccgaggccttcaacaaatatggagccaactgtggt |