Detail of EST/Unigene TCAA53741 |
Acc. | TCAA53741 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Probable mediator of RNA polymerase II transcription subunit 37e OS=Arabidopsis thaliana E-value=3e-87; Heat shock 70 kDa protein 3 OS=Arabidopsis thaliana E-value=7e-87; Chloroplast envelope membrane 70 kDa heat shock-related protein OS=Spinacia oleracea E-value=4e-86; Probable mediator of RNA polymerase II transcription subunit 37c OS=Arabidopsis thaliana E-value=5e-86; Heat shock cognate 70 kDa protein 2 OS=Solanum lycopersicum E-value=5e-86; |
Length | 804 nt |
Species | Artemisia annua |
Belonged EST Libraries | AA_CAIY (23 ESTs); AA_GTRI4 (6 ESTs); AA_GTRI5 (4 ESTs); AA_GTRI3 (4 ESTs); LIBEST_025693 (3 ESTs); AA_CAIT (1 ESTs); |
Sequence | AAAAGAAACCTAAGATACCAGAACGAAATTCATAGATAATTCCAGGGCAATATCGCCCAA |
EST members of Unigene | EY040597 EY060018 EY040598 EY045761 EY039938 EY045762 EY051527 EY058476 EY060017 EY043784 EY043783 GW332957 EY044203 EY044204 EY046747 EY046748 EY049227 EY049228 GW331492 EY051528 EY058477 EY031877 EY068131 EY044696 EY045458 EY039939 EY044697 EY067788 EY067789 EY040750 EY061538 EY061537 EY038667 GW332389 EY039479 EY039480 EY034387 EY038296 EY038297 EY071819 EY038666 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K03283 heat shock 70kDa protein 1/8 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | 1.A.3 Ryanodine-inositol-1,4,5-trisphosphate receptor Ca2+ channel RIR-CaC; 1.A.33 Cation-channel-forming heat-shock protein 70 Hsp70 |
Probeset |
|
Corresponding NCBI Gene | 831020 |
Trichome-related Gene from Literature | 831020 |