| Detail of EST/Unigene TCHL53959 |
| Acc. | TCHL53959 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase, chloroplastic OS=Arabidopsis thaliana E-value=0; 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase, chloroplastic OS=Oryza sativa subsp. japonica E-value=0; 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase OS=Protochlamydia amoebophila (strain UWE25) E-value=0; 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase OS=Leptospira borgpetersenii serovar Hardjo-bovis (strain L550) E-value=4e-88; 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase OS=Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197) E-value=4e-88; |
| Length | 1841 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546165 (25 ESTs); SRR546172 (13 ESTs); HL_TRI (13 ESTs); SRR546170 (7 ESTs); HLUTR3CH (7 ESTs); SRR546168 (6 ESTs); HLUTR2CH (4 ESTs); HLUPLC (1 ESTs); HLUPJN1 (1 ESTs); |
| Sequence | ACCATAAATAGAAAATGACCCTAGGACATTTCCTATGCCCCCATTTTAGAATTATCCAAT |
| EST members of Unigene | ES655942 SRR546172.83508 ES657822 SRR546172.89313 SRR546165.24312 SRR546170.20645 SRR546172.161192 SRR546165.32422 SRR546172.166007 SRR546172.85233 GD248330 SRR546165.295995 GD248408 SRR546172.76149 EX519709 SRR546170.10187 SRR546168.21208 SRR546165.18711 GD251083 SRR546172.60003 ES658165 ES658642 SRR546170.155936 SRR546172.1800 ES656416 SRR546170.25123 ES656406 GD242792 ES653061 SRR546172.149629 GD249309 SRR546172.20926 SRR546165.73224 SRR546165.152449 SRR546168.3664 SRR546165.311721 SRR546165.308541 SRR546172.119238 GD251188 SRR546165.145016 ES658393 ES656856 SRR546172.96191 SRR546165.209353 SRR546165.49927 GD245997 SRR546165.47409 SRR546165.132435 SRR546168.134756 SRR546170.152891 SRR546165.75613 ES658285 GD252578 GD252888 SRR546165.81631 SRR546165.239324 SRR546165.132494 SRR546172.84441 SRR546165.280134 EX519670 SRR546165.215197 ES656238 GD250473 GD252694 SRR546170.8607 SRR546168.68708 GD248467 GD248464 SRR546165.186573 SRR546165.283001 SRR546168.50341 SRR546165.184442 SRR546165.211064 SRR546168.93946 SRR546165.56461 SRR546170.6036 SRR546165.213381 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 836181 |
| Trichome-related Gene from Literature | 836181 |