| Detail of EST/Unigene TCHL54588 |
| Acc. | TCHL54588 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable 1-deoxy-D-xylulose-5-phosphate synthase, chloroplastic OS=Capsicum annuum E-value=0; 1-deoxy-D-xylulose-5-phosphate synthase 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=0; 1-deoxy-D-xylulose-5-phosphate synthase, chloroplastic OS=Arabidopsis thaliana E-value=0; Probable 1-deoxy-D-xylulose-5-phosphate synthase 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=0; 1-deoxy-D-xylulose-5-phosphate synthase OS=Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182) E-value=0; |
| Length | 1486 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546165 (43 ESTs); SRR546168 (21 ESTs); SRR546172 (20 ESTs); HLUTR2CH (4 ESTs); HL_TRI (4 ESTs); SRR546170 (4 ESTs); HLUPJN1 (3 ESTs); HLUTR3CH (3 ESTs); HLUPLC (2 ESTs); |
| Sequence | TCAGTGCATGAATTGGCTACAAAAGTTGATGAATATGCTCGTGGTATGATAAGTGGTTCT |
| EST members of Unigene | GD244002 SRR546168.90404 SRR546168.66831 SRR546170.73004 SRR546165.151852 SRR546172.146317 SRR546168.100647 SRR546165.170024 GD248578 SRR546172.20331 SRR546168.94086 SRR546165.67224 SRR546168.163 GD248647 SRR546168.118790 SRR546165.128841 SRR546168.32040 SRR546172.27269 SRR546165.203624 SRR546168.96572 SRR546165.6313 SRR546172.80404 SRR546165.249042 SRR546172.107281 SRR546168.122663 SRR546168.86326 SRR546172.148461 SRR546165.321957 SRR546168.20702 SRR546168.104750 SRR546165.267866 SRR546165.217232 SRR546165.272119 ES658314 SRR546165.111144 GD243653 SRR546165.286041 SRR546172.153344 SRR546168.33838 SRR546172.128775 GD247174 SRR546172.109822 SRR546168.65310 SRR546165.125020 SRR546165.114972 SRR546165.303580 SRR546168.19722 SRR546172.105972 GD253424 GD247477 SRR546165.239630 SRR546172.81079 SRR546165.261316 SRR546165.270807 SRR546172.140813 SRR546165.29826 GD247944 SRR546165.174564 SRR546165.236604 SRR546168.113891 SRR546172.81882 SRR546165.110800 SRR546165.254395 SRR546168.116799 SRR546165.76007 SRR546165.82192 SRR546172.158379 GD249780 ES655728 SRR546165.41410 SRR546168.132042 SRR546170.109221 SRR546172.116076 SRR546172.132500 SRR546170.121011 SRR546165.317364 SRR546168.16500 ES652578 SRR546172.159427 SRR546165.269503 GD242866 SRR546165.83793 SRR546172.91014 SRR546168.86505 SRR546165.263327 SRR546165.202832 SRR546165.110654 GD244844 SRR546165.147195 SRR546165.42454 SRR546170.85516 SRR546165.229303 SRR546165.148885 SRR546172.149916 SRR546165.151396 SRR546165.262712 SRR546165.215170 SRR546165.197974 SRR546172.41915 SRR546165.151214 GD253312 SRR546165.40687 SRR546168.114888 ES656998 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00030 Pentose phosphate pathway > K00615 transketolase; Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K00615 transketolase; Metabolism > Biosynthesis of Polyketides and Nonribosomal Peptides > ko01051 Biosynthesis of ansamycins > K00615 transketolase |
| EC | 2.2.1.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827230 |
| Trichome-related Gene from Literature | 827230 |