Detail of EST/Unigene TCMT40605 |
Acc. | TCMT40605 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Spermine synthase OS=Arabidopsis thaliana E-value=3e-58; Spermidine synthase 1 OS=Arabidopsis thaliana E-value=2e-31; Spermidine synthase OS=Solanum lycopersicum E-value=2e-30; Spermidine synthase 2 OS=Datura stramonium E-value=3e-30; Spermidine synthase OS=Coffea arabica E-value=4e-30; |
Length | 851 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2 (4 ESTs); MTAMP (1 ESTs); MT_DLEAF (1 ESTs); MT_SROOT_KV2 (1 ESTs); MT_JAS_ROOR (1 ESTs); |
Sequence | GATTACGCCAAGCTCGAAATTTACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGC |
EST members of Unigene | AW688517 AW692347 AW696281 AW691006 AJ503914 BG453849 BM779484 CX529125 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K00797 spermidine synthase; Metabolism > Amino Acid Metabolism > ko00220 Urea cycle and metabolism of amino groups > K00797 spermidine synthase; Metabolism > Metabolism of Other Amino Acids > ko00410 beta-Alanine metabolism > K00797 spermidine synthase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00797 spermidine synthase |
EC | 2.5.1.16 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.41032.1.S1_at
|
Corresponding NCBI Gene | 835392 |
Trichome-related Gene from Literature | N/A |