Detail of EST/Unigene TCMT41255 |
Acc. | TCMT41255 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Beta-glucosidase 11 OS=Arabidopsis thaliana E-value=3e-73; Beta-glucosidase 3 OS=Arabidopsis thaliana E-value=9e-65; Beta-glucosidase 4 OS=Arabidopsis thaliana E-value=3e-62; Hydroxyisourate hydrolase OS=Glycine max E-value=1e-61; Beta-glucosidase 10 OS=Arabidopsis thaliana E-value=4e-61; |
Length | 804 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DROOT (2 ESTs); MT_HOGA (1 ESTs); |
Sequence | GATTTTGCCTTATAGAGAGCCAAGGGTAACTCAACATTTGAACCGTACTTGGTAGTTCAT |
EST members of Unigene | BE320002 BE320721 BG648857 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K01229 lactase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K05350 beta-glucosidase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K05350 beta-glucosidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K05350 beta-glucosidase |
EC | 3.2.1.108 3.2.1.21 3.2.1.62 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.12281.1.S1_s_at
|
Corresponding NCBI Gene | 839435 |
Trichome-related Gene from Literature | N/A |