Detail of EST/Unigene TCMT41285 |
Acc. | TCMT41285 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Isoflavone 2'-hydroxylase OS=Glycyrrhiza echinata E-value=7e-41; Cytochrome P450 81D1 OS=Arabidopsis thaliana E-value=2e-35; Cytochrome P450 81F1 OS=Arabidopsis thaliana E-value=1e-33; Cytochrome P450 71B2 OS=Arabidopsis thaliana E-value=3e-29; Cytochrome P450 71A1 OS=Persea americana E-value=8e-29; |
Length | 903 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SIRRA (2 ESTs); MT_Drought (1 ESTs); MT_DLEAF (1 ESTs); MT_GPOD (1 ESTs); |
Sequence | AAGATCAATTACTATTTGTGGTTGTAAAACACTATCTGCAATAGATATTTTATGATCAAA |
EST members of Unigene | BG454723 CA916838 BQ154772 BI269213 BE248513 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00232 Caffeine metabolism > K07411 cytochrome P450, family 2, subfamily A; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07411 cytochrome P450, family 2, subfamily A; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K07411 cytochrome P450, family 2, subfamily A; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07411 cytochrome P450, family 2, subfamily A |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.13071.1.S1_at
|
Corresponding NCBI Gene | 816854 |
Trichome-related Gene from Literature | N/A |