Detail of EST/Unigene TCMT41290 |
Acc. | TCMT41290 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Late embryogenesis abundant protein 2 OS=Cicer arietinum E-value=2e-46; Late embryogenesis abundant protein 1 OS=Cicer arietinum E-value=6e-46; Late embryogenesis abundant protein D-7 OS=Gossypium hirsutum E-value=5e-23; Late embryogenesis abundant protein Dc3 OS=Daucus carota E-value=2e-22; Late embryogenesis abundant protein 76 OS=Brassica napus E-value=8e-19; |
Length | 778 nt |
Species | Medicago truncatula |
Belonged EST Libraries | GLSD (38 ESTs); MT_Drought (6 ESTs); MtBC_GLOMUS (5 ESTs); MT_DLEAF (5 ESTs); MT_JCVI-MT2 (3 ESTs); MT_GESD (3 ESTs); MT_SIRRA (1 ESTs); |
Sequence | AAAACAGCTTGAGATAACCATAAGAGGAAAGATTCTAGCGAGTAAACCTGCTATTTCAAT |
EST members of Unigene | AL387886 AL387179 AL386369 AL384628 AL384627 CA991332 BI310763 BI310377 BG454568 BG453210 BG452969 BG452597 BG452452 CA989841 CA989829 CA989776 CA989703 CA989573 CA989554 CA989497 CA989492 CA989438 CA989331 CA989297 CA989289 CA859024 CA858652 CA858034 CA858008 BQ124975 BQ124974 BQ124958 BQ124874 BQ124683 BQ124604 BQ124561 BQ124536 BQ124046 BQ123994 BQ123927 BQ123571 BQ123296 BQ123216 BQ123145 BQ123071 BQ123069 BQ122962 BQ122776 BQ122589 BQ122439 BQ122315 BI269561 BF635256 BF635075 BF634900 BF634684 BF632671 BF632600 GE349050 GE347118 GE343911 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.1254.1.S1_at, Mtr.12327.1.S1_s_at
|
Corresponding NCBI Gene | 841701 |
Trichome-related Gene from Literature | N/A |