| Detail of EST/Unigene TCMT41889 |
| Acc. | TCMT41889 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable glutathione S-transferase OS=Nicotiana tabacum E-value=3e-73; Probable glutathione S-transferase parC OS=Nicotiana tabacum E-value=3e-72; Glutathione S-transferase U25 OS=Arabidopsis thaliana E-value=2e-68; Glutathione S-transferase U19 OS=Arabidopsis thaliana E-value=2e-68; Probable glutathione S-transferase parA OS=Nicotiana tabacum E-value=4e-68; |
| Length | 648 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT (3 ESTs); MT_DSIL (2 ESTs); MT_DSLC (2 ESTs); MT_Shoots (1 ESTs); MT_DFLOWER (1 ESTs); MT_DLEAF (1 ESTs); |
| Sequence | ATCTCACTCTATAAGAGAGTTCCAACCTTTATCCTTTGTCACAGCCACACATTTCTTCTT |
| EST members of Unigene | CX528110 BF006409 BF005520 BQ149742 BG452299 BF519508 BF518954 BI267859 BE322656 BF640143 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
| EC | 2.5.1.18 |
| Transcription Factor Family | |
| Transporter Classification Family | 1.A.1 Voltage-gated ion channel superfamily VIC; 1.A.12 Organellar chloride channel O-ClC |
| Probeset |
Msa.1237.1.S1_s_at
|
| Corresponding NCBI Gene | 844174 |
| Trichome-related Gene from Literature | N/A |