Detail of EST/Unigene TCMT42206 |
Acc. | TCMT42206 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Hydroxyisourate hydrolase OS=Glycine max E-value=8e-74; Beta-glucosidase 11 OS=Arabidopsis thaliana E-value=1e-69; Beta-glucosidase 3 OS=Arabidopsis thaliana E-value=2e-56; Beta-glucosidase 10 OS=Arabidopsis thaliana E-value=5e-56; Beta-glucosidase 9 OS=Arabidopsis thaliana E-value=3e-55; |
Length | 991 nt |
Species | Medicago truncatula |
Belonged EST Libraries | GLSD (1 ESTs); MT_KVKC (1 ESTs); MTUS_MIXTISSUE (1 ESTs); MT_ROOTPHOS (1 ESTs); |
Sequence | GGCCCAAATCAAAGAACTAGATACCATTGTTAATGGGAGATCACTCACTTTATGATGATT |
EST members of Unigene | CA921970 AW126066 CA858386 BQ255176 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K01229 lactase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K05350 beta-glucosidase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K05350 beta-glucosidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K05350 beta-glucosidase |
EC | 3.2.1.108 3.2.1.21 3.2.1.62 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.42974.1.S1_s_at
|
Corresponding NCBI Gene | 839435 |
Trichome-related Gene from Literature | N/A |