| Detail of EST/Unigene TCMT42206 |
| Acc. | TCMT42206 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Hydroxyisourate hydrolase OS=Glycine max E-value=8e-74; Beta-glucosidase 11 OS=Arabidopsis thaliana E-value=1e-69; Beta-glucosidase 3 OS=Arabidopsis thaliana E-value=2e-56; Beta-glucosidase 10 OS=Arabidopsis thaliana E-value=5e-56; Beta-glucosidase 9 OS=Arabidopsis thaliana E-value=3e-55; |
| Length | 991 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTUS_MIXTISSUE (1 ESTs); MT_ROOTPHOS (1 ESTs); GLSD (1 ESTs); MT_KVKC (1 ESTs); |
| Sequence | GGCCCAAATCAAAGAACTAGATACCATTGTTAATGGGAGATCACTCACTTTATGATGATT |
| EST members of Unigene | CA921970 AW126066 CA858386 BQ255176 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K01229 lactase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K05350 beta-glucosidase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K05350 beta-glucosidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K05350 beta-glucosidase |
| EC | 3.2.1.108 3.2.1.21 3.2.1.62 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.42974.1.S1_s_at
|
| Corresponding NCBI Gene | 839435 |
| Trichome-related Gene from Literature | N/A |