| Detail of EST/Unigene TCMT43995 |
| Acc. | TCMT43995 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | UDP-glucose flavonoid 3-O-glucosyltransferase 6 OS=Fragaria ananassa E-value=0; Putative UDP-glucose flavonoid 3-O-glucosyltransferase 3 OS=Fragaria ananassa E-value=0; UDP-glycosyltransferase 71B2 OS=Arabidopsis thaliana E-value=1e-99; Anthocyanidin 3-O-glucosyltransferase 1 OS=Manihot esculenta E-value=2e-98; Anthocyanidin 3-O-glucosyltransferase 6 (Fragment) OS=Manihot esculenta E-value=2e-92; |
| Length | 1595 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_ECELL (3 ESTs); MTUS_MIXTISSUE (2 ESTs); MT_PhoLEAF (1 ESTs); MT_MGHG (1 ESTs); MtBC_GLOMUS (1 ESTs); MT_IROOT_DSIR (1 ESTs); |
| Sequence | TGTATATCCTATTATCCTGTGCTTCAAGATGAAGAAAGCAGAAGTGGTGTTTATCCCTTT |
| EST members of Unigene | CF068376 CA919060 AL389419 AW268023 BQ135889 BF649924 BF646045 BE323213 BE941222 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00699 glucuronosyltransferase; Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00860 Porphyrin and chlorophyll metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K00699 glucuronosyltransferase; |
| EC | 2.4.1.17 2.4.1.47 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.10880.1.S1_at
|
| Corresponding NCBI Gene | 821730 |
| Trichome-related Gene from Literature | N/A |