Detail of EST/Unigene TCMT44086 |
Acc. | TCMT44086 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 4-coumarate--CoA ligase-like 7 OS=Arabidopsis thaliana E-value=0; 4-coumarate--CoA ligase-like 1 OS=Oryza sativa subsp. japonica E-value=0; 4-coumarate--CoA ligase-like 5 OS=Arabidopsis thaliana E-value=1e-81; 4-coumarate--CoA ligase-like 6 OS=Arabidopsis thaliana E-value=1e-78; 4-coumarate--CoA ligase-like 2 OS=Arabidopsis thaliana E-value=2e-78; |
Length | 1283 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SEEDROOT_KV3 (2 ESTs); MT_JCVI-MT2 (2 ESTs); MTUS_MIXTISSUE (1 ESTs); MT_IROOT_DSIR (1 ESTs); |
Sequence | ACGGGGAGAAGCAAGGGAGTGATGCTGACTCACCAGAACTTAATAGCTACAGCGGTGGCG |
EST members of Unigene | CA921826 AW560507 BG646004 AW774328 GE346644 GE346643 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00650 Butanoate metabolism > K01896 medium-chain acyl-CoA synthetase; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K01897 long-chain acyl-CoA synthetase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K01904 4-coumarate--CoA ligase |
EC | 6.2.1.12 6.2.1.3 |
Transcription Factor Family | |
Transporter Classification Family | 2.A.1 Major facilitator superfamily MFS |
Probeset |
Mtr.12988.1.S1_at
|
Corresponding NCBI Gene | 825864 |
Trichome-related Gene from Literature | N/A |