Detail of EST/Unigene TCMT45145 |
Acc. | TCMT45145 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Aldo-keto reductase family 4 member C9 OS=Arabidopsis thaliana E-value=4e-44; Aldo-keto reductase family 4 member C11 OS=Arabidopsis thaliana E-value=9e-43; Probable NAD(P)H-dependent oxidoreductase 2 OS=Oryza sativa subsp. japonica E-value=7e-42; Aldo-keto reductase family 4 member C10 OS=Arabidopsis thaliana E-value=1e-41; Aldo-keto reductase family 4 member C8 OS=Arabidopsis thaliana E-value=4e-38; |
Length | 681 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBC_GLOMUS (1 ESTs); MT_DROOT (1 ESTs); MT_DLEAF (1 ESTs); |
Sequence | GAAAAACATGGCAGGAAACAAAATTCCAGAAGTGTTATTGAATTCAGGACACAAAATGCC |
EST members of Unigene | AL381799 BE320370 BF637050 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00051 Fructose and mannose metabolism > K00011 aldehyde reductase; Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K00011 aldehyde reductase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00011 aldehyde reductase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00011 aldehyde reductase; Metabolism > Lipid Metabolism > ko00561 Glycerolipid metabolism > K00011 aldehyde reductase; Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00037 3-alpha-hydroxysteroid dehydrogenase; Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K00037 3-alpha-hydroxysteroid dehydrogenase; Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00037 3-alpha-hydroxysteroid dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00212 trans-1,2-dihy |
EC | 1.1.1.21 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.44844.1.S1_at
|
Corresponding NCBI Gene | 842290 |
Trichome-related Gene from Literature | N/A |