Detail of EST/Unigene TCMT45412 |
Acc. | TCMT45412 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Single-stranded DNA-binding protein, mitochondrial OS=Arabidopsis thaliana E-value=1e-68; Single-stranded DNA-binding protein OS=Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp) E-value=5e-11; Single-stranded DNA-binding protein OS=Wigglesworthia glossinidia brevipalpis E-value=5e-10; Plasmid-derived single-stranded DNA-binding protein OS=Escherichia coli E-value=4e-09; Plasmid-derived single-stranded DNA-binding protein OS=Escherichia coli E-value=4e-09; |
Length | 903 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2 (3 ESTs); |
Sequence | GGGTTGCAGTTCCTCGTTTGCTGGAAATGAATTCTGTTGCGCTAAGACTTTCCAAGCATC |
EST members of Unigene | GE351254 GE346715 GE346714 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Replication and Repair > ko03030 DNA replication > K03111 single-strand DNA-binding protein; Genetic Information Processing > Replication and Repair > ko03440 Homologous recombination > K03111 single-strand DNA-binding protein; Genetic Information Processing > Replication and Repair > ko03430 Mismatch repair > K03111 single-strand DNA-binding protein |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.49989.1.S1_at
|
Corresponding NCBI Gene | 826707 |
Trichome-related Gene from Literature | N/A |