Detail of EST/Unigene TCMT46626 |
Acc. | TCMT46626 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase zeta class OS=Euphorbia esula E-value=1e-75; Glutathione S-transferase Z2 OS=Arabidopsis thaliana E-value=2e-69; Glutathione S-transferase Z1 OS=Arabidopsis thaliana E-value=3e-69; Glutathione S-transferase 1 OS=Dianthus caryophyllus E-value=7e-63; Glutathione S-transferase OS=Triticum aestivum E-value=2e-54; |
Length | 1018 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER (1 ESTs); MT_SROOT_KV0 (1 ESTs); MT_HOGA (1 ESTs); MT_INSECT (1 ESTs); MT_ECELL (1 ESTs); MT_JCVI-MT1 (1 ESTs); MT_SEEDROOT_KV3 (1 ESTs); |
Sequence | GACAATTGAGGATGGTAGATCTTTTCTAGAATGGTGGGAGTCATGTAAGTTTTGTATGTT |
EST members of Unigene | BF645166 EV259682 AW774823 BI270339 BE204101 CB894949 BF642243 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00643 Styrene degradation > K01800 maleylacetoacetate isomerase; Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K01800 maleylacetoacetate isomerase |
EC | 2.5.1.18 5.2.1.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.40617.1.S1_at
|
Corresponding NCBI Gene | 814769 |
Trichome-related Gene from Literature | N/A |