Detail of EST/Unigene TCMT47077 |
Acc. | TCMT47077 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Hexokinase-1 OS=Arabidopsis thaliana E-value=0; Hexokinase-1 OS=Spinacia oleracea E-value=0; Hexokinase-2 OS=Arabidopsis thaliana E-value=1e-99; Hexokinase-1 OS=Nicotiana tabacum E-value=2e-98; Hexokinase-2 OS=Oryza sativa subsp. japonica E-value=9e-98; |
Length | 1340 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBC_GLOMUS (2 ESTs); MT_GESD (2 ESTs); MtBA (2 ESTs); MT_SROOT_KV2 (1 ESTs); |
Sequence | ACCAAGTCCTTGGAAAAAGTTGGCCTGCATATGCGCGTGACAGCTCTCATTAACGACACC |
EST members of Unigene | AL384823 AL384822 CA990076 BI310261 AW299210 AL371772 AL371771 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00521 Streptomycin biosynthesis > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00530 Aminosugars metabolism > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00051 Fructose and mannose metabolism > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00844 hexokinase |
EC | 2.7.1.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.43041.1.S1_at
|
Corresponding NCBI Gene | 829034 |
Trichome-related Gene from Literature | 829034 |