| Detail of EST/Unigene TCMT47176 |
| Acc. | TCMT47176 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | UDP-glycosyltransferase 73C5 OS=Arabidopsis thaliana E-value=0; UDP-glycosyltransferase 73C1 OS=Arabidopsis thaliana E-value=1e-99; UDP-glycosyltransferase 73C3 OS=Arabidopsis thaliana E-value=2e-99; UDP-glycosyltransferase 73C6 OS=Arabidopsis thaliana E-value=1e-98; UDP-glycosyltransferase 73C4 OS=Arabidopsis thaliana E-value=6e-98; |
| Length | 1284 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTUS_MIXTISSUE (1 ESTs); MT_JCVI-MT1 (1 ESTs); MT_JAS_ROOR (1 ESTs); MT_JCVI-MT2 (1 ESTs); |
| Sequence | TGATTGGTTTAGCTTAATGTGGTGGATGGGTGCTGGTAGGTGCTTGAGGGATAGCTTGAT |
| EST members of Unigene | CA920602 EV262257 CX535481 GE351931 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00699 glucuronosyltransferase; Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00860 Porphyrin and chlorophyll metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K00699 glucuronosyltransferase; |
| EC | 2.4.1.17 2.4.1.47 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.43961.1.S1_at
|
| Corresponding NCBI Gene | 818252 |
| Trichome-related Gene from Literature | N/A |