Detail of EST/Unigene TCMT47271 |
Acc. | TCMT47271 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Calcium-dependent protein kinase SK5 OS=Glycine max E-value=0; Calcium-dependent protein kinase 11 OS=Arabidopsis thaliana E-value=0; Calcium-dependent protein kinase 12 OS=Arabidopsis thaliana E-value=0; Calcium-dependent protein kinase 4 OS=Arabidopsis thaliana E-value=0; Calcium-dependent protein kinase 2 OS=Arabidopsis thaliana E-value=0; |
Length | 1751 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTGIM (3 ESTs); MT_SROOT_KV2 (1 ESTs); MT_HOGA (1 ESTs); MT_INSECT (1 ESTs); MT_DROOT (1 ESTs); MT_DSTEM2 (1 ESTs); MT_ECELL (1 ESTs); |
Sequence | TTTGTCTTTGTGTCTTCTTTTTCTCTTTCTGAACCAAACACCAAACACAGTACAACGTTG |
EST members of Unigene | BE319758 AW694011 BF645197 AJ499223 AJ500699 AJ500590 BM779035 BG647837 BI265824 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04020 Calcium signaling pathway > K04515 calcium/calmodulin-dependent protein kinase (CaM kinase) II; Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04515 calcium/calmodulin-dependent protein kinase (CaM kinase) II; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K04515 calcium/calmodulin-dependent protein kinase (CaM kinase) II |
EC | 2.7.11.17 |
Transcription Factor Family | WRKY |
Transporter Classification Family | 9.A.1 Polysaccharide transporter PST; 9.A.14 Nuclear pore complex NPC |
Probeset |
Mtr.38201.1.S1_at
|
Corresponding NCBI Gene | 840471 |
Trichome-related Gene from Literature | N/A |