| Detail of EST/Unigene TCMT47398 |
| Acc. | TCMT47398 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase T1 OS=Arabidopsis thaliana E-value=1e-75; Glutathione S-transferase T2 OS=Arabidopsis thaliana E-value=8e-75; Glutathione S-transferase T3 OS=Arabidopsis thaliana E-value=2e-74; Glutathione S-transferase theta-2 OS=Mus musculus E-value=2e-21; Glutathione S-transferase theta-2 OS=Rattus norvegicus E-value=7e-21; |
| Length | 1226 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBC_GLOMUS (3 ESTs); MT_FLOSEED_MTY (1 ESTs); MT_NOD_ROOT (1 ESTs); MT_JAS_ROOR (1 ESTs); MT_SROOT_KV1 (1 ESTs); |
| Sequence | AGTATCATTTATCATCGTATATATATAGTATATAGATTTTGTTTTCGTTTTTGATTTATC |
| EST members of Unigene | AL389439 AL389438 AL385699 DW016313 AW686793 CX531127 BE202544 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
| EC | 2.5.1.18 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.26627.1.S1_at
|
| Corresponding NCBI Gene | 834123 |
| Trichome-related Gene from Literature | N/A |