Detail of EST/Unigene TCMT47780 |
Acc. | TCMT47780 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Fructose-1,6-bisphosphatase, chloroplastic OS=Spinacia oleracea E-value=8e-66; Fructose-1,6-bisphosphatase, chloroplastic OS=Brassica napus E-value=1e-65; Fructose-1,6-bisphosphatase, chloroplastic OS=Arabidopsis thaliana E-value=3e-65; Fructose-1,6-bisphosphatase, chloroplastic OS=Pisum sativum E-value=4e-63; Fructose-1,6-bisphosphatase, chloroplastic OS=Triticum aestivum E-value=2e-62; |
Length | 1233 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1 (2 ESTs); MT_Shoots (1 ESTs); MT_INSECT (1 ESTs); MT_JCVI-MT3 (1 ESTs); |
Sequence | CCCAAATGAAAATGGAAACTTTTTGCTGAAACTTGGATAAGTTTTGACACTATGCAGTCA |
EST members of Unigene | CX523640 EV260081 EV255601 BI267194 EY476449 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00051 Fructose and mannose metabolism > K03841 fructose-1,6-bisphosphatase I; Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K03841 fructose-1,6-bisphosphatase I; Metabolism > Carbohydrate Metabolism > ko00030 Pentose phosphate pathway > K03841 fructose-1,6-bisphosphatase I; Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K03841 fructose-1,6-bisphosphatase I |
EC | 3.1.3.11 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.12196.1.S1_at
|
Corresponding NCBI Gene | 836559 |
Trichome-related Gene from Literature | N/A |