Detail of EST/Unigene TCMT47849 |
Acc. | TCMT47849 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Anthranilate synthase component II OS=Cyanophora paradoxa E-value=3e-58; Anthranilate synthase component II OS=Porphyra purpurea E-value=2e-51; Anthranilate synthase component II OS=Thermotoga maritima (strain ATCC 43589 / MSB8 / DSM 3109 / JCM 10099) E-value=1e-49; Anthranilate synthase component II OS=Porphyra yezoensis E-value=3e-49; Anthranilate synthase component II OS=Pseudomonas putida E-value=3e-47; |
Length | 1183 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1 (2 ESTs); MT_DSIL (1 ESTs); MT_JCVI-MT3 (1 ESTs); MT_CDS (1 ESTs); |
Sequence | GACAGTTCGGTCAATTGAATTCAAACAAACACAACAATGGCTGCCACATTCATTTCTCGA |
EST members of Unigene | BT052186 EV261400 EV258700 BF520906 EY477339 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K01951 GMP synthase (glutamine-hydrolysing); Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K01951 GMP synthase (glutamine-hydrolysing); Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01951 GMP synthase (glutamine-hydrolysing) |
EC | 6.3.5.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.2104.1.S1_at
|
Corresponding NCBI Gene | 835900 |
Trichome-related Gene from Literature | N/A |