| Detail of EST/Unigene TCMT48681 |
| Acc. | TCMT48681 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 71A8 OS=Mentha piperita E-value=4e-71; Cytochrome P450 71A1 OS=Persea americana E-value=2e-70; Psoralen synthase OS=Ammi majus E-value=8e-67; Cytochrome P450 71A25 OS=Arabidopsis thaliana E-value=2e-65; Cytochrome P450 71A6 (Fragment) OS=Nepeta racemosa E-value=4e-65; |
| Length | 781 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTUS_MIXTISSUE (1 ESTs); MT_SROOT_KV2 (1 ESTs); |
| Sequence | TGACTTTGTTGATGTTTTGCTTTGGATCCAAAGGACAGAAATCCCTAGGTTTTCCTATTG |
| EST members of Unigene | CA922627 BM779277 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00512 cytochrome P450, family 17, subfamily A (steroid 17alpha-monooxygenase); Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07418 cytochrome P450, family 2, subfamily J; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07418 cytochrome P450, family 2, subfamily J |
| EC | 1.14.14.1 1.14.99.9 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.10175.1.S1_at
|
| Corresponding NCBI Gene | 823986 |
| Trichome-related Gene from Literature | N/A |