| Detail of EST/Unigene TCMT50515 |
| Acc. | TCMT50515 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | UDP-glycosyltransferase 85A3 OS=Arabidopsis thaliana E-value=3e-74; UDP-glycosyltransferase 85A5 OS=Arabidopsis thaliana E-value=2e-72; UDP-glycosyltransferase 85A1 OS=Arabidopsis thaliana E-value=5e-72; UDP-glycosyltransferase 85A2 OS=Arabidopsis thaliana E-value=4e-69; UDP-glycosyltransferase 85A7 OS=Arabidopsis thaliana E-value=2e-68; |
| Length | 1642 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Shoots (2 ESTs); MT_DSLC (2 ESTs); MT_DLEAF (1 ESTs); MT_DSIL (1 ESTs); MT_INSECT (1 ESTs); |
| Sequence | ATAGGTCACAAAATTAAGATTTTTTGAAAAATGGAAACACAACCTAAGGAAAAATCTTCT |
| EST members of Unigene | CX528172 CX524814 BF006376 BF006250 BE318995 AW776033 BF640002 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00699 glucuronosyltransferase; Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00860 Porphyrin and chlorophyll metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K00699 glucuronosyltransferase |
| EC | 2.4.1.17 2.4.1.45 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.11119.1.S1_at
|
| Corresponding NCBI Gene | 838845 |
| Trichome-related Gene from Literature | N/A |