Detail of EST/Unigene TCMT51086 |
Acc. | TCMT51086 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Lysophosphatidylcholine acyltransferase 2 OS=Danio rerio E-value=1e-10; Lysophosphatidylcholine acyltransferase 2 OS=Homo sapiens E-value=1e-10; Lysophosphatidylcholine acyltransferase 2 OS=Mus musculus E-value=4e-10; Lysophosphatidylcholine acyltransferase 1 OS=Danio rerio E-value=9e-10; 1-acylglycerophosphocholine O-acyltransferase 1 OS=Drosophila melanogaster E-value=1e-08; |
Length | 1088 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTUS_MIXTISSUE (1 ESTs); MT_SEEDROOT_KV3 (1 ESTs); MT_GPOD (1 ESTs); MT_SROOT_KV1 (1 ESTs); |
Sequence | ATGTGCACTTTGATCAATCTTGGGGCAACGTTTCTTTGGGACAGCTTATGTTCAGGATGT |
EST members of Unigene | CF069094 AW774555 BI309235 BE203228 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | ; Environmental Information Processing > Signal Transduction > ko04020 Calcium signaling pathway > K06268 protein phosphatase 3, regulatory subunit; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K06268 protein phosphatase 3, regulatory subunit; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K06268 protein phosphatase 3, regulatory subunit; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K06268 protein phosphatase 3, regulatory subunit |
EC | 2.3.1.- 2.3.1.23 2.3.1.67 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.42296.1.S1_at
|
Corresponding NCBI Gene | 819175 |
Trichome-related Gene from Literature | N/A |