Detail of EST/Unigene TCMT52038 |
Acc. | TCMT52038 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 93A3 OS=Glycine max E-value=3e-51; Cytochrome P450 93A1 OS=Glycine max E-value=2e-49; Cytochrome P450 93A2 OS=Glycine max E-value=1e-44; Beta-amyrin 24-hydroxylase OS=Glycine max E-value=5e-43; Licodione synthase OS=Glycyrrhiza echinata E-value=4e-38; |
Length | 709 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_IROOT_DSIR (1 ESTs); MT_JCVI-MT3 (1 ESTs); |
Sequence | TAGTTAGTGATCATAACTTTGAACCTTAATCATGGTTGATTTTAGTGACTATTTTGCACT |
EST members of Unigene | AW559376 EY475089 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00512 cytochrome P450, family 17, subfamily A (steroid 17alpha-monooxygenase); Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1 |
EC | 1.14.14.1 1.14.99.9 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.1553.1.S1_at
|
Corresponding NCBI Gene | 830580 |
Trichome-related Gene from Literature | N/A |