Detail of EST/Unigene TCMT52243 |
Acc. | TCMT52243 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Ribonucleoside-diphosphate reductase small chain OS=Nicotiana tabacum E-value=0; Ribonucleoside-diphosphate reductase small chain C OS=Arabidopsis thaliana E-value=0; Putative ribonucleoside-diphosphate reductase small chain B OS=Arabidopsis thaliana E-value=0; Ribonucleoside-diphosphate reductase small chain OS=Trypanosoma brucei brucei E-value=5e-93; Ribonucleoside-diphosphate reductase subunit M2 OS=Danio rerio E-value=4e-91; |
Length | 891 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_NOLLY (1 ESTs); MT_ROOTPHOS (1 ESTs); |
Sequence | CTAAAATCTCTTCCTTCTCAAATAATCACTATTTTCATAATCACTTTTTTCTCTCAATTT |
EST members of Unigene | DY617143 AW329800 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K10808 ribonucleoside-diphosphate reductase subunit M2; Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K10808 ribonucleoside-diphosphate reductase subunit M2; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K10808 ribonucleoside-diphosphate reductase subunit M2 |
EC | 1.17.4.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.32118.1.S1_at, Mtr.32118.1.S1_x_at
|
Corresponding NCBI Gene | 822324 |
Trichome-related Gene from Literature | N/A |