Detail of EST/Unigene TCMT52803 |
Acc. | TCMT52803 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Defensin-like protein 19 OS=Arabidopsis thaliana E-value=3e-13; Defensin-like protein 1 OS=Clitoria ternatea E-value=1e-11; Defensin-like protein 1 OS=Dahlia merckii E-value=1e-10; Anther-specific protein SF18 (Fragment) OS=Helianthus annuus E-value=1e-09; Defensin-like protein 1 OS=Aesculus hippocastanum E-value=7e-09; |
Length | 550 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTGIM (18 ESTs); MtBC_GLOMUS (7 ESTs); MTAMP (1 ESTs); |
Sequence | GCGGGGGACAAGAAATAAAACATCATTTCCATTTACATTAAGCAAGCATGGCTTCATCTA |
EST members of Unigene | AL388726 AL388725 AL387300 AL387299 AL383916 AL383557 AL383556 AJ502212 AJ499952 AJ499945 AJ499925 AJ499841 AJ499760 AJ499675 AJ499347 AJ499336 AJ499325 AJ499268 AJ500674 AJ500612 AJ500594 AJ500553 AJ500483 AJ500390 AJ500203 AJ500150 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | 1.C.4 Aerolysin channel-forming toxin Aerolysin; 1.C.45 Plant defensin PD |
Probeset |
Mtr.7210.1.S1_at
|
Corresponding NCBI Gene | 838548 |
Trichome-related Gene from Literature | N/A |