Detail of EST/Unigene TCMT53630 |
Acc. | TCMT53630 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Isocitrate dehydrogenase [NADP], chloroplastic (Fragment) OS=Medicago sativa E-value=0; Isocitrate dehydrogenase [NADP] OS=Solanum tuberosum E-value=0; Isocitrate dehydrogenase [NADP] OS=Nicotiana tabacum E-value=0; Isocitrate dehydrogenase [NADP] OS=Glycine max E-value=0; Isocitrate dehydrogenase [NADP], mitochondrial OS=Mus musculus E-value=0; |
Length | 1039 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2 (3 ESTs); MT_IROOT_DSIR (1 ESTs); MT_SEEDROOT_KV3 (1 ESTs); MT_Drought (1 ESTs); MT_JCVI-MT2 (1 ESTs); |
Sequence | GGTGAAAACAAACAAGAAAGTGTTGAAACAAACGAACCAACAAAGTACGAGGTTGGGTCT |
EST members of Unigene | AW559917 AW692899 AW694578 AW689032 BG645983 BF635580 GE347405 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00020 Citrate cycle (TCA cycle) > K00031 isocitrate dehydrogenase; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K00031 isocitrate dehydrogenase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00031 isocitrate dehydrogenase |
EC | 1.1.1.42 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.12788.1.S1_at, Mtr.12788.1.S1_s_at
|
Corresponding NCBI Gene | 842905 |
Trichome-related Gene from Literature | N/A |