| Detail of EST/Unigene TCMT54400 |
| Acc. | TCMT54400 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Rac-like GTP-binding protein ARAC8 OS=Arabidopsis thaliana E-value=0; Rac-like GTP-binding protein ARAC10 OS=Arabidopsis thaliana E-value=0; Rac-like GTP-binding protein 3 OS=Oryza sativa subsp. japonica E-value=0; Rac-like GTP-binding protein 4 OS=Oryza sativa subsp. japonica E-value=5e-99; Rac-like GTP-binding protein RAC1 OS=Lotus japonicus E-value=2e-90; |
| Length | 1119 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_CDS (2 ESTs); MT_JCVI-MT1 (1 ESTs); MT_JCVI-MT3 (1 ESTs); |
| Sequence | ATACATAAACACACAAACTCTCTCTTTTCTCATCTAACAAAAACAAAACACTCATTTCAT |
| EST members of Unigene | BT051478 EU625287 EV258537 EY474011 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1 |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | 9.A.5 Peroxisomal protein importer PPI |
| Probeset |
Mtr.3206.1.S1_at
|
| Corresponding NCBI Gene | 823959 |
| Trichome-related Gene from Literature | N/A |