Detail of EST/Unigene TCMT54453 |
Acc. | TCMT54453 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Proline--tRNA ligase OS=Roseiflexus castenholzii (strain DSM 13941 / HLO8) E-value=1e-38; Proline--tRNA ligase OS=Chloroflexus aurantiacus (strain ATCC 29364 / DSM 637 / Y-400-fl) E-value=4e-38; Proline--tRNA ligase OS=Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl) E-value=4e-38; Proline--tRNA ligase OS=Roseiflexus sp. (strain RS-1) E-value=3e-37; Proline--tRNA ligase OS=Chloroflexus aggregans (strain MD-66 / DSM 9485) E-value=1e-36; |
Length | 781 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSLC (1 ESTs); MTGIM (1 ESTs); MT_TRI (1 ESTs); |
Sequence | GGAAGTTCTTAATGCAGCATTGTCTGTAAAAGAAGCTCTTCAAAGCTCTGGCGTTAAAGT |
EST members of Unigene | BF005464 AJ500294 EX526876 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00330 Arginine and proline metabolism > K01881 prolyl-tRNA synthetase; Genetic Information Processing > Translation > ko00970 Aminoacyl-tRNA biosynthesis > K01881 prolyl-tRNA synthetase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01885 glutamyl-tRNA synthetase; Metabolism > Metabolism of Cofactors and Vitamins > ko00860 Porphyrin and chlorophyll metabolism > K01885 glutamyl-tRNA synthetase; Genetic Information Processing > Translation > ko00970 Aminoacyl-tRNA biosynthesis > K01885 glutamyl-tRNA synthetase |
EC | 6.1.1.15 6.1.1.17 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.39618.1.S1_at
|
Corresponding NCBI Gene | 835328 |
Trichome-related Gene from Literature | N/A |