Detail of EST/Unigene TCMT55554 |
Acc. | TCMT55554 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Bifunctional phosphatase IMPL2, chloroplastic OS=Arabidopsis thaliana E-value=0; Histidinol-phosphatase OS=Chlorobaculum parvum (strain NCIB 8327) E-value=7e-28; Histidinol-phosphatase OS=Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / LMG 3730 / NCIMB 10025) E-value=5e-23; Histidinol-phosphatase OS=Mycobacterium tuberculosis E-value=3e-22; Inositol-1-monophosphatase OS=Pasteurella multocida (strain Pm70) E-value=1e-21; |
Length | 1054 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1 (1 ESTs); MtBA (1 ESTs); |
Sequence | ATCCGTCTTCCTCTCCAACGACACCTGAGTTGAAATGTTGTTGTCACAGTGTCATCTTCT |
EST members of Unigene | EV260353 AL372220 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00521 Streptomycin biosynthesis > K01092 myo-inositol-1(or 4)-monophosphatase; Metabolism > Carbohydrate Metabolism > ko00562 Inositol phosphate metabolism > K01092 myo-inositol-1(or 4)-monophosphatase; Environmental Information Processing > Signal Transduction > ko04070 Phosphatidylinositol signaling system > K01092 myo-inositol-1(or 4)-monophosphatase |
EC | 3.1.3.25 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.17107.1.S1_at
|
Corresponding NCBI Gene | 830067 |
Trichome-related Gene from Literature | N/A |