| Detail of EST/Unigene TCMT55786 |
| Acc. | TCMT55786 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase U19 OS=Arabidopsis thaliana E-value=1e-65; Glutathione S-transferase U25 OS=Arabidopsis thaliana E-value=3e-62; Probable glutathione S-transferase OS=Nicotiana tabacum E-value=2e-61; Glutathione S-transferase U20 OS=Arabidopsis thaliana E-value=4e-61; Glutathione S-transferase U21 OS=Arabidopsis thaliana E-value=6e-61; |
| Length | 1094 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTGIM (37 ESTs); MtBC_GLOMUS (6 ESTs); MT_CDS (1 ESTs); MTAMP (1 ESTs); |
| Sequence | CAAAGATCAAACACTAAATATGGTTGATAAGTTAGCATACTCATTATAGTGGAAAAGAAA |
| EST members of Unigene | AY134608 AL388771 AL387620 AL387619 AL386766 AL386765 AL383447 AJ501070 AJ499974 AJ499896 AJ499852 AJ499776 AJ499682 AJ499617 AJ499589 AJ499578 AJ499464 AJ499457 AJ499392 AJ499343 AJ499306 AJ499298 AJ499228 AJ499169 AJ500938 AJ500935 AJ500925 AJ500825 AJ500821 AJ500717 AJ500706 AJ500652 AJ500552 AJ500551 AJ500439 AJ500416 AJ500384 AJ500354 AJ500331 AJ500278 AJ500260 AJ500183 AJ500117 AJ500066 AJ500059 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
| EC | 2.5.1.18 |
| Transcription Factor Family | |
| Transporter Classification Family | 1.A.1 Voltage-gated ion channel superfamily VIC; 1.A.12 Organellar chloride channel O-ClC |
| Probeset |
Mtr.15957.1.S1_at
|
| Corresponding NCBI Gene | 844174 |
| Trichome-related Gene from Literature | N/A |