Detail of EST/Unigene TCMT56370 |
Acc. | TCMT56370 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase, chloroplastic OS=Arabidopsis thaliana E-value=5e-83; 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase, chloroplastic OS=Catharanthus roseus E-value=8e-81; 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-77; 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase OS=Ralstonia metallidurans (strain CH34 / ATCC 43123 / DSM 2839) E-value=2e-41; 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase OS=Bordetella avium (strain 197N) E-value=5e-41; |
Length | 941 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF (2 ESTs); MT_JCVI-MT2 (2 ESTs); MT_FLOSEED_MTY (2 ESTs); MT_DFLOWER (1 ESTs); MT_PhoLEAF (1 ESTs); MT_INSECT (1 ESTs); MT_JCVI-MT3 (1 ESTs); MT_TRI (1 ESTs); MT_ECELL (1 ESTs); |
Sequence | GGATATGATAGTGTCTGAAAACTGAAATTCACCATCTCCTTAACTTCAACAACCAAACAT |
EST members of Unigene | BF645377 DW019416 DW016866 BQ147611 BG454366 BE316292 BI263296 BE321485 EY476768 GE352357 GE348030 EX529581 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.41248.1.S1_at
|
Corresponding NCBI Gene | 842700 |
Trichome-related Gene from Literature | 842700 |